Fork me on GitHub
Software Parameter Function More
SnpEff Available Databases java -jar snpEff.jar databases Genome This command provides a list of configured databases, i.e. available in snpEff.config file. Show
REDItoolKnown.py REDItoolKnown.py -i rnaseq.bam -f reference.fa -l knownEditingSites.tab REDItoolKnown.py has been developed to explore the RNA editing potential of RNA-Seq data sets using known editing events. Such events can be downloaded from DARNED database or generated from supplementary materials of a variety of publications. Known RNA editing events have to be stored in TAB files (see above for details). Show
FreeBayes freebayes [OPTION] ... [BAM FILE] ... FreeBayes is a Bayesian genetic variant detector designed to find small polymorphisms, specifically SNPs (single-nucleotide polymorphisms), indels (insertions and deletions), MNPs (multi-nucleotide polymorphisms), and complex events (composite insertion and substitution events) smaller than the length of a short-read sequencing alignment. Show
samtools samtools mpileup [-EBugp] [-C capQcoef] [-r reg] [-f in.fa] [-l list] [-Q minBaseQ] [-q minMapQ] in.bam [in2.bam [...]] Report variants for one or multiple BAM files. Alignment records are grouped by sample identifiers in @RG header lines. If sample identifiers are absent, each input file is regarded as one sample. Show
REDItoolDenovo.py REDItoolDenovo.py -i rnaseq.bam -f reference.fa REDItoolDenovo.py has been conceived to predict potential RNA editing events using RNA-Seq data alone and without any a priori knowledge about genome information and biological properties of RNA editing phenomenon. Show
FilterTable.py FilterTable.py -i mytable -s dbsnp137.gtf.gz -S snp -o mytable_filtered -E -p FilterTable.py filters positions of a input table according to specific annotations indexed by tabix tool. Filtered out positions will be marked with “#” at the beginning of each line. To exclude such lines the option -E should be used. Features are the same as indicated in the third field of GTF annotation file. Show
bcftools view bcftools view [OPTIONS] file.vcf.gz [REGION […]] This tool converts BCF files into VCF files using BCFtools view from the SAMtools set of utilities. Show
GEMINI windower gemini windower -w 50000 -s 0 -t nucl_div -o mean my.db Conducting analyses on genome “windows”. Show
selectPositions.py selectPositions.py -i unselected_positions.txt -o selected_positions.txt selectPositions.py can filter an output REDItool table according to different criteria. Show
REDItoolBlatCorrection.py REDItoolBlatCorrection.py -i rnaseq.bam -f reference.fa -F reference.2bit -o BlatCorrection -V -T REDItoolBlatCorrection.py requires gfServer and gfClient programs from Blat package . Reference fasta file can be converted in .2bit format using the utility faToTwoBit. Show
GEMINI de_novo gemini de_novo --columns "chrom,start,end" test.de_novo.db You can use this tool for identifying de novo (a.k.a spontaneous) mutations that arise in offspring. Show
REDItoolDnaRna.py REDItoolDnaRna.py -i rnaseq.bam -j dnaseq.bam -f myreference.fa -o myoutputfolder REDItoolDnaRna.py is the main script devoted to the identification of RNA editing events taking into account the combined information from RNA-Seq and DNA-Seq data in BAM format. To look at potential RNA editing candidates, RNA-Seq data alone can be used. Show
GEMINI set_somatic gemini set_somatic --min-depth 30 --min-qual 20 --min-somatic-score 18 --min-tumor-depth 10 --min-norm-depth 10 tumor_normal.db Flag somatic variants. Show
GEMINI load gemini load -v my.vcf -p my.ped my.db Loading a VCF file into GEMINI Show
GEMINI actionable_mutations gemini actionable_mutations tumor_normal.db This tool reports actionable mutations as well as their known drug interactions (if any) from DGIdb. Show
GEMINI lof_sieve gemini lof_sieve chr22.low.exome.snpeff.100samples.vcf.db he lof_sieve tool reports the fractional position (e.g. 0.05 for the first 5%) of the mutation in the amino acid sequence. In addition, it also reports the predicted function of the transcript so that one can segregate candidate LoF variants that affect protein_coding transcripts from processed RNA, etc. Show
GEMINI stats gemini stats --tstv my.db The stats tool computes some useful variant statistics. Show
GEMINI amend gemini load -v my.vcf -p samples.ped -t VEP my.db The amend tool allows one to provide an updated PED file as input and it will update each sample_id in the PED file that matches a sample_id. Show
vg vg align -s CTACTGACAGCAGAAGTTTGCTGTGAAGATTAAATTAGGTGATGCTTG x.vg If it is a small graph, you could align to it using a full-length partial order alignment Show
GEMINI mendel_errors gemini mendel_errors --columns "chrom,start,end" test.mendel.db --gt-pl-max 1 Identify non-mendelian transmission Show