Variant Analysis

GEMINI roh
Function: The ‘roh’ tool in GEMINI returns runs of homozygosity identified in whole genome data.
Usage: gemini roh --min-snps 50 --min-gt-depth 20 --min-size 1000000 -s S138 roh_run.db
GEMINI lof_sieve
Function: he lof_sieve tool reports the fractional position (e.g. 0.05 for the first 5%) of the mutation in the amino acid sequence. In addition, it also reports the predicted function of the transcript so that one can segregate candidate LoF variants that affect protein_coding transcripts from processed RNA, etc.
Usage: gemini lof_sieve chr22.low.exome.snpeff.100samples.vcf.db
VarScan
Function: Call indels from a mpileup file based on user-defined parameters
Usage: java -jar VarScan.jar mpileup2indel [mpileup file] OPTIONS
GEMINI db_info
Function: List the gemini database tables and columns.
Usage: gemini db_info test.db
vg
Function: filter secondary and ambiguous read mappings out of the gam
Usage: vg filter graph.vg alignment.gam -r 0.90 -afu -s 2 -o 0 --defray_ends 999 > filtered.gam
samtools phase
Function: Call and phase heterozygous SNPs.
Usage: samtools phase [-AF] [-k len] [-b prefix] [-q minLOD] [-Q minBaseQ] <in.bam>
VarScan
Function: Call indels from a pileup file based on user-defined parameters
Usage: java -jar VarScan.jar pileup2indel [pileup file] OPTIONS
vg
Function: surject the alignments back into the reference space of sequence "x", yielding a BAM file
Usage: vg surject -p x -b -d x.vg.index aln.gam >aln.bam
VarScan
Function: Make consensus calls (SNP/Indel/Reference) from a pileup file based on user-defined parameters
Usage: java -jar VarScan.jar pileup2cns [pileup file] OPTIONS
VarScan
Function: Call SNPs from an mpileup file based on user-defined parameters
Usage: java -jar VarScan.jar mpileup2snp [mpileup file] OPTIONS
vg
Function: align a read to the indexed version of the graph
Usage: vg map -s CTACTGACAGCAGAAGTTTGCTGTGAAGATTAAATTAGGTGATGCTTG -x x.xg -g x.gcsa -k 22 >read.gam