-
Function: This command provides a list of configured databases, i.e. available in snpEff.config file.
Usage: java -jar snpEff.jar databases Genome
-
Function: FreeBayes is a Bayesian genetic variant detector designed to find small polymorphisms, specifically SNPs (single-nucleotide polymorphisms), indels (insertions and deletions), MNPs (multi-nucleotide polymorphisms), and complex events (composite insertion and substitution events) smaller than the length of a short-read sequencing alignment.
Usage: freebayes [OPTION] ... [BAM FILE] ...
-
Function: This tool converts BCF files into VCF files using BCFtools view from the SAMtools set of utilities.
Usage: bcftools view [options] <in.vcf.gz> [region1 [...]]
Supported input format:
VCF
-
Function: REDItoolDenovo.py has been conceived to predict potential RNA editing events using RNA-Seq data alone and without any a priori knowledge about genome information and biological properties of RNA editing phenomenon.
Usage: REDItoolDenovo.py -i rnaseq.bam -f reference.fa
-
Function: REDItoolKnown.py has been developed to explore the RNA editing potential of RNA-Seq data sets using known editing events. Such events can be downloaded from DARNED database or generated from supplementary materials of a variety of publications. Known RNA editing events have to be stored in TAB files (see above for details).
Usage: REDItoolKnown.py -i rnaseq.bam -f reference.fa -l knownEditingSites.tab
-
Function: REDItoolDnaRna.py is the main script devoted to the identification of RNA editing events taking into account the combined information from RNA-Seq and DNA-Seq data in BAM format. To look at potential RNA editing candidates, RNA-Seq data alone can be used.
Usage: REDItoolDnaRna.py -i rnaseq.bam -j dnaseq.bam -f myreference.fa -o myoutputfolder
-
Function: Report variants for one or multiple BAM files. Alignment records are grouped by sample identifiers in @RG header lines. If sample identifiers are absent, each input file is regarded as one sample.
Usage: samtools mpileup [-EBugp] [-C capQcoef] [-r reg] [-f in.fa] [-l list] [-Q minBaseQ] [-q minMapQ] in.bam [in2.bam [...]]
-
Function: You can use this tool for identifying de novo (a.k.a spontaneous) mutations that arise in offspring.
Usage: gemini de_novo --columns "chrom,start,end" test.de_novo.db
-
Function: Call SNPs from a pileup file based on user-defined parameters
Usage: java -jar VarScan.jar pileup2snp [pileup file] OPTIONS
-
Function: selectPositions.py can filter an output REDItool table according to different criteria.
Usage: selectPositions.py -i unselected_positions.txt -o selected_positions.txt
-
Function: FilterTable.py filters positions of a input table according to specific annotations indexed by tabix tool. Filtered out positions will be marked with “#†at the beginning of each line. To exclude such lines the option -E should be used. Features are the same as indicated in the third field of GTF annotation file.
Usage: FilterTable.py -i mytable -s dbsnp137.gtf.gz -S snp -o mytable_filtered -E -p
-
Function: REDItoolBlatCorrection.py requires gfServer and gfClient programs from Blat package . Reference fasta file can be converted in .2bit format using the utility faToTwoBit.
Usage: REDItoolBlatCorrection.py -i rnaseq.bam -f reference.fa -F reference.2bit -o BlatCorrection -V -T
-
Function: Flag somatic variants.
Usage: gemini set_somatic --min-depth 30 --min-qual 20 --min-somatic-score 18 --min-tumor-depth 10 --min-norm-depth 10 tumor_normal.db
-
Function: If it is a small graph, you could align to it using a full-length partial order alignment
Usage: vg align -s CTACTGACAGCAGAAGTTTGCTGTGAAGATTAAATTAGGTGATGCTTG x.vg
-
Function: This command downloads and installs a database.
Usage: java -jar snpEff.jar download -v WBcel215.69